Data of self-made Taq DNA polymerase prepared for screening purposes.

Data of self-made Taq DNA polymerase prepared for screening purposes.

DNA analysis is a key procedure in genetic engineering. Nowadays, the analysis is often made by PCR with the Taq DNA polymerase. Although the last enzyme price is quite low, the demand for many analyzes leads to many money expenses that are not affordable for many laboratories. In another, many screening tasks do not require highly purified enzyme. Given the unique properties of enzyme that it simplifies its production slightly without resorting to expensive or long techniques such as column chromatography and / or dialysis. Here, the data of the routine use of Taq DNA polymerase prepared according to the protocol developed in our laboratory are presented.

The protocol only takes several hours and does not need qualified personnel or expensive equipment. Yet it gives the preparation of the enzyme adapted to most screening objectives. The isolated Taq DNA polymerase stock can be stored as a suspension of ammonium sulphate in a refrigerator for a long time, at least 6 months. The work enzyme solution is prepared from the on-demand stock suspension, no more than once a month and can also be stored in a refrigerator. The new generation sequencing technology has allowed the detection of rare genetic or somatic mutations and contributed to our understanding of the progression and evolution of the disease.

However, many new generation sequencing technologies first rely on the amplification of DNA, via the reaction of the polymerase chain (PCR), as part of the sample preparation workflow. The errors performed during PCR appear in sequencing data and contribute to false mutations that can define a genetic analysis. In this ratio, a sequencing test at a molecule at a molecule was used to completely catalog the different types of errors introduced during the PCR, including a polymerase interporation, a model switching induced by the structure, a structure. recombination mediated by PCR and DNA damage. In addition to the well-characterized polymerase basic substitution errors, other sources of error have been considered widespread. PCR-mediated recombination per TAQ polymerase has been observed at the single molecule, and surprising would occur as often as basic polymerase substitution errors suggesting that it may be a source of underestimated error for multiplex amplification reactions.


A new method based on fast and fast PCR for genotype mice with a mutation of the leptin receptors (DB / DB mouse).

DB / DB mice are one of the most widely used animal models to study cellular and molecular mechanisms of metabolic disorders, such as diabetes, hyperlipidemia and obesity. The mice carry spontaneous punctual mutations in the gene coding the leptin receptor, resulting in the inactivation of the receptors of the leptin. Since homozygous DB / DB mice are sterile, dB / dB mouse maintenance requires reproduction between heterozygous pairs, which makes genotyping essential to the identification of the offspring. The purpose of this study was to develop a fast and very repeatable method for the genotyping of DB / DB mice, which included only three simple steps: genomic DNA is extracted from third tail or ear notches via a alkaline lysis (approximately20 min);

The samples are then subjected to the reaction of the chain of the chain of the refractory mutation of the tetra-primer-amplification amplification (PCR) using specially designed and validated primer assemblies (~ 17 h); Finally, genotypes are determined by solving PCR products on regular DNA electrophoresis (~ 10 min). The entire DB / DB mouse genotyping procedure can be performed using a regular amplification of the Taq polymerase and PCR within 2 h. The other advantages of this method include high sensitivity and reproducibility. Minimum amounts of mouse tissue are required and genomic samples of the DNA can be stably stored at room temperature for a maximum month. In conclusion, the method is simple, cost-effective, sensitive and reliable, which will greatly facilitate studies using DB / DB mice.

 Data of self-made Taq DNA polymerase prepared for screening purposes.
Data of self-made Taq DNA polymerase prepared for screening purposes.

Association of polymorphism of vitamin D receptor genes in patients with type 2 diabetes in the Kashmir Valley.

About 1 billion people in various ethnic and elderly groups have vitamin D deficiency. The high prevalence of such a disability is an imperative public health problem, because hypovitaminosis D is an autonomous risk factor for mortality in the mortality. population in general. Beyond bone integrity and calcium homeostasis, it is involved in many physiological and pathological processes. The role of vitamin D in the pathogenesis and prevention of type 2 diabetes mellitus aroused universal interest.

This case study at the hospital has been designed to study the combination between 25-hydroxy vitamin D (25 [oh] d) levels and polymorphism of vitamin D genes (VDR) with diabetes and to evaluate their roles As factors of risk of diabetes. 100 cases and controls have been taken. 25 (OH) D levels were analyzed by the chemioleneescence method using a Siemens Advia Centaur analyzer. The genomic DNA has been extracted and the Taq-1 and BSM-1 genotyping in the VDR gene has been performed using the reaction of the polymerization chain followed by a restriction fragment length polymorphism (PCR-RFLP) .

(Oh) The levels of patients with diabetes were significantly lower than those of the controls (19.26 ± 0.95 ng / ml against 25.49 ± 1.02 ng / ml; p = 0.001). (OH) The levels of have been found inversely associated with percentages of glyceated hemoglobin in cases (R2 = 0.74). The results suggest that BSM-1 allele and B (G ALLLE) simple nucleotide polymorphisms could be a susceptibility allele for the diabetes of the Cashmiri population.

Recombinant Measles Virus Large Polymerase (58-149)

7-07838 500µg Ask for price

Recombinant Measles Virus Large Polymerase (58-149)

7-07839 1000µg Ask for price

Measles Virus Large Polymerase (58-149) Protein

  • EUR 885.00
  • EUR 342.00
  • EUR 1609.00
  • 0.5 mg
  • 100 ug
  • 1 mg
  • Shipped within 5-10 working days.

Recombinant Measles Virus MV Large Polymerase 58-149 a. a Protein, Untagged, E.coli-100ug

QP12758-100ug 100ug
EUR 218

Recombinant Measles Virus MV Large Polymerase 58-149 a. a Protein, Untagged, E.coli-1mg

QP12758-1mg 1mg
EUR 1261

Recombinant Measles Virus MV Large Polymerase 58-149 a. a Protein, Untagged, E.coli-500ug

QP12758-500ug 500ug
EUR 663

Recombinant (E.Coli) Measles Virus Large Polymerase (58-149)

RP-651 100 ug
EUR 286

Recombinant (E.Coli) purified Measles virus Large Polymerase (58-149)

RP-1613 100 ug
EUR 347

Recombinant MeV Active Large Polymerase Protein (aa 58-149)

VAng-Lsx0397-inquire inquire Ask for price
Description: Measles Active Large Polymerase protein (aa 58-149), recombinant protein from E. coli.

Recombinant MeV Polymerase Protein (aa 58-149)

VAng-Lsx0394-inquire inquire Ask for price
Description: MeV Polymerase (aa 58-149), recombinant protein from E. coli.

EM (Anti-endometrial Antibody IgA) ELISA test

58 96T/Box Ask for price
  • Area of application: Immunological infertility
Description: ELISA based test for quantitative detection of EM (Anti-endometrial Antibody IgA)

Bst DNA Polymerase Large Fragment

P701-01 800 U
EUR 122

Bst DNA Polymerase Large Fragment

P701-02 8000 U
EUR 271

Bst DNA Polymerase, Large Fragment

EUR 289

Bsu DNA Polymerase Large Fragment

EUR 398

Recombinant MeV Large Polymerase Protein

VAng-Lsx0385-inquire inquire Ask for price
Description: Recombinant MeV Large Polymerase containing the large polymerase immunodominant regions, 58-149 amino acids was expressed in E. coli and purified by proprietary chromatographic technique.

Recombinant HPV-58 E6 (aa 1-149) Protein

VAng-Wyb3337-1mgEcoli 1 mg (E. coli)
EUR 3158
Description: Human papillomavirus type 58 protein E6, recombinant protein.

Recombinant HPV-58 E6 (aa 1-149) Protein

VAng-Wyb3337-500gEcoli 500 µg (E. coli)
EUR 2250
Description: Human papillomavirus type 58 protein E6, recombinant protein.

Recombinant HPV-58 E6 (aa 1-149) Protein

VAng-Wyb3337-50gEcoli 50 µg (E. coli)
EUR 1549
Description: Human papillomavirus type 58 protein E6, recombinant protein.

Mouse pre-microRNA Expression Construct mir-149

MMIR-149-PA-1 Bacterial Streak
EUR 684
  • Category: MicroRNA Tools

DNA Polymerase I Large (Klenow) Fragment

EUR 278

Recombinant Measles Virus Large Polymerase (2059-2183)

7-07843 100µg Ask for price

Recombinant Measles Virus Large Polymerase (2059-2183)

7-07844 500µg Ask for price

Recombinant Measles Virus Large Polymerase (2059-2183)

7-07845 1000µg Ask for price

Bsu DNA Polymerase Large Fragment - 1,000 units

3585 1/EA
EUR 305

Sau DNA Polymerase Large Fragment - 1,000 units

3595 1/EA
EUR 508

Measles Virus Large Polymerase (2059-2183) Protein

  • EUR 885.00
  • EUR 342.00
  • EUR 1609.00
  • 0.5 mg
  • 100 ug
  • 1 mg
  • Shipped within 5-10 working days.

Cyanine 3.5 Maleimide [equivalent to Cy3.5® Maleimide]

149 1 mg
EUR 306
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

DNA Polymerase I, Large (Klenow) Fragment - 1,000 units

3262 1/EA
EUR 289

Cenarchaeum symbiosum DNA polymerase II large subunit (polC)

  • EUR 621.00
  • EUR 381.00
  • EUR 1943.00
  • EUR 882.00
  • EUR 1335.00
  • EUR 451.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 59 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Cenarchaeum symbiosum DNA polymerase II large subunit(polC),partial expressed in E.coli

Recombinant (E.Coli) Measles Virus Large Polymerase (2059-2183)

RP-653 100 ug
EUR 286

Recombinant (E.Coli) purified Measles virus Large Polymerase (2059-2183)

RP-1612 100 ug
EUR 347

Recombinant MeV Active Large Polymerase Protein (aa 2059-2183)

VAng-Lsx0399-inquire inquire Ask for price
Description: Measles Active Large Polymerase protein (aa 2059-2183), recombinant protein from E. coli.

Human morbillivirus,MV ELISA Kit

201-12-1791 96 tests
EUR 440
  • This morbillivirus ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

ph/mv/ion/o2 module

D291 ea
EUR 649

Human morbillivirus(MV)ELISA Kit

GA-E1807HM-48T 48T
EUR 289

Human morbillivirus(MV)ELISA Kit

GA-E1807HM-96T 96T
EUR 466

Human morbillivirus(MV)ELISA Kit

QY-E02207 96T
EUR 361

Canine morbillivirus,MV ELISA KIT

QY-E70150 96T
EUR 426

MG 149

B3276-100 100 mg
EUR 837
Description: MG 149 is an inhibitor of histone acetyltransferases (HAT) with IC50 values of 74?M and 47?M for Tip60 and MOF, respectively [1].MG 149 is an anacardic acid derivative.

MG 149

B3276-25 25 mg
EUR 437
Description: MG 149 is an inhibitor of histone acetyltransferases (HAT) with IC50 values of 74?M and 47?M for Tip60 and MOF, respectively [1].MG 149 is an anacardic acid derivative.

MG 149

B3276-5 5 mg
EUR 168
Description: MG 149 is an inhibitor of histone acetyltransferases (HAT) with IC50 values of 74?M and 47?M for Tip60 and MOF, respectively [1].MG 149 is an anacardic acid derivative.

MG 149

HY-15887 50mg
EUR 1042


EUR 153


EUR 457


EUR 131


B6025-25 25 mg
EUR 438
Description: DASA-58 is an selective activator of pyruvate kinase M2 (PKM2) with an AC90 value of 680 nM, and an AC50 value of 38 nM [1].In cancer, the altered glucose metabolism can be influenced by the regulatory properties of PKM2.


B6025-5 5 mg
EUR 171
Description: DASA-58 is an selective activator of pyruvate kinase M2 (PKM2) with an AC90 value of 680 nM, and an AC50 value of 38 nM [1].In cancer, the altered glucose metabolism can be influenced by the regulatory properties of PKM2.


A3429-10 10 mg
EUR 144
Description: GANT 58 is an antagonist of GLI that inhibits GLI1-induced transcription with an IC50 value of 5 ?M [1]. GLI1 is a human glioblastoma isolated protein which belongs to GLI protein family.


A3429-100 100 mg
EUR 537
Description: GANT 58 is an antagonist of GLI that inhibits GLI1-induced transcription with an IC50 value of 5 ?M [1]. GLI1 is a human glioblastoma isolated protein which belongs to GLI protein family.


A3429-5 5 mg
EUR 109
Description: GANT 58 is an antagonist of GLI that inhibits GLI1-induced transcription with an IC50 value of 5 ?M [1]. GLI1 is a human glioblastoma isolated protein which belongs to GLI protein family.


A3429-5.1 10 mM (in 1mL DMSO)
EUR 121
Description: GANT 58 is an antagonist of GLI that inhibits GLI1-induced transcription with an IC50 value of 5 ?M [1]. GLI1 is a human glioblastoma isolated protein which belongs to GLI protein family.


A3429-50 50 mg
EUR 383
Description: GANT 58 is an antagonist of GLI that inhibits GLI1-induced transcription with an IC50 value of 5 ?M [1]. GLI1 is a human glioblastoma isolated protein which belongs to GLI protein family.


HY-12498 5mg
EUR 463


HY-13282 10mM/1mL
EUR 134


HY-19330 100mg
EUR 1566

Brij 58

B6306 250g
EUR 216.75
  • Product category: Biochemicals/Detergents/Surfactants

miRZip-149 anti-miR-149 microRNA construct

MZIP149-PA-1 Bacterial Streak
EUR 684
  • Category: MicroRNA Tools

Pig Cholecystokinin 58 (CCK-58) ELISA Kit

abx361664-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

IFNG a.a. Interferon-gamma 139 a.a Human Recombinant Protein

PROTP01579-2 Regular: 10ug
EUR 317
Description: IFNG 139 a.a. Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 139 amino acids (24-161 a.a.) and having a molecular mass of 16.3kDa.; IFNG 139 a.a. is purified by proprietary chromatographic techniques.

CGI-58 Antibody

EUR 316

CGI-58 Antibody

EUR 146

LARGE antibody

70R-6856 50 ug
EUR 467
Description: Rabbit polyclonal LARGE antibody raised against the middle region of LARGE


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human measlesvirus IgM,MV IgM ELISA kit

201-12-1765 96 tests
EUR 440
  • This measlesvirus IgM ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human measlesvirus IgG,MV IgG ELISA Kit

201-12-1773 96 tests
EUR 440
  • This measlesvirus IgG ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

redox standard solution 50 ml 124 mv

B071 ea
EUR 22

redox standard solution 50 ml 358 mv

B072 ea
EUR 22

redox standard solution 500 ml 124 mv

B571 ea
EUR 36

redox standard solution 500 ml 358 mv

B572 ea
EUR 36

Human measlesvirus IgM(MV IgM)ELISA Kit

GA-E1781HM-48T 48T
EUR 289

Human measlesvirus IgM(MV IgM)ELISA Kit

GA-E1781HM-96T 96T
EUR 466

Human measlesvirus IgG(MV IgG)ELISA Kit

GA-E1789HM-48T 48T
EUR 289

Human measlesvirus IgG(MV IgG)ELISA Kit

GA-E1789HM-96T 96T
EUR 466

Human measlesvirus IgM(MV IgM)ELISA Kit

QY-E02205 96T
EUR 361

Human measlesvirus IgG(MV IgG)ELISA Kit

QY-E02206 96T
EUR 361

IL36A a.a. Interleukin-36 Alpha 153 a.a Mouse Recombinant Protein

PROTQ9JLA2-1 Regular: 10ug
EUR 317
Description: IL36A 153 a.a. Mouse Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 153 amino acids (8-160a.a.) and having a molecular mass of 17.0kDa.;The IL36A 153 a.a. Mouse is purified by proprietary chromatographic techniques.

IL36B a.a. Interleukin-36 Beta 153 a.a Human Recombinant Protein

PROTQ9NZH7-1 Regular: 10ug
EUR 317
Description: IL36B 153 a.a. Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 153 amino acids (5-157a.a.) and having a molecular mass of 17.2kDa.;The IL36B 153 a.a. Human is purified by proprietary chromatographic techniques.

IL36G a.a. Interleukin-36 Gamma (152 a.a) Human Recombinant Protein

PROTQ9NZH8-1 Regular: 10ug
EUR 317
Description: IL36G (152 a.a.) Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 152 amino acids and having a molecular mass of 17.0kDa.;The IL36G (152 a.a.) is purified by proprietary chromatographic techniques.

HBcAg (a.a. 80) Antibody

abx021791-100ug 100 ug
EUR 565
  • Shipped within 5-10 working days.

ITLN1 298 a.a. Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

HIF1a (85 a.a.) Protein

  • EUR 230.00
  • EUR 1609.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.

IL16 (121 a.a.) Protein

  • EUR 328.00
  • EUR 5826.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

IL13 109 a.a. Protein

  • EUR 328.00
  • EUR 5826.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

IL16 (130 a.a.) Protein

  • EUR 328.00
  • EUR 5826.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

IL36G 152 a.a. Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

IL36A 158 a.a. Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

IL36B 153 a.a. Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

IL36A 153 a.a. Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Native Microorganism Glycerol Kinase

DIA-149 10 KU
EUR 335

Recombinant Human C1QL4 Protein

CTP-149 100ug Ask for price
Description: A recombinant human C1QL4 protein with a N-terminal tag or C-terminal tag expressed in E. Coli, yeast, insect, or mammalian cell.

Rac1 Recombinant Adenovirus

ADV-149 50 ?L
EUR 891
Description: Premade recombinant adenovirus containing the Rac1 gene

Monkey (Cynomolgus) cDNA Normal Tissue: Liver

MC34-149 10 rxn
EUR 415

AKAP 149 Polyclonal Antibody

ABP50622-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human AKAP 149 at AA range: 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of AKAP 149 from Human. This AKAP 149 antibody is for WB , IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AKAP 149 at AA range: 250-330

AKAP 149 Polyclonal Antibody

ABP50622-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human AKAP 149 at AA range: 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of AKAP 149 from Human. This AKAP 149 antibody is for WB , IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AKAP 149 at AA range: 250-330

AKAP 149 Polyclonal Antibody

ABP50622-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human AKAP 149 at AA range: 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of AKAP 149 from Human. This AKAP 149 antibody is for WB , IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AKAP 149 at AA range: 250-330

Chemerin-9 (149-157)

HY-P1844 10mg
EUR 567

AKAP 149 Polyclonal Antibody

ES1621-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AKAP 149 from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

AKAP 149 Polyclonal Antibody

ES1621-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AKAP 149 from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

hsa-miR-149 Primers

MPH01178 150 ul / 10 uM
EUR 121

mmu-miR-149 Primers

MPM00094 150 ul / 10 uM
EUR 121

Anti-AKAP 149 antibody

STJ91528 200 µl
EUR 197
Description: Rabbit polyclonal to AKAP 149.

BAY 58-2667 Hydrochloride

EUR 370

BAY 58-2667 Hydrochloride

2027-10 Ask for price

Myc (Ab-58) Antibody

21034-100ul 100ul
EUR 252

Myc (Ab-58) Antibody

21034-50ul 50ul
EUR 187

CGI-58 Blocking Peptide

EUR 153

FluM1 A2 (58-66)

5-01152 4 x 5mg Ask for price

MYC (Ab-58) Antibody

EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against MYC (Ab-58). Recognizes MYC (Ab-58) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:200

MYC (Ab-58) Antibody

CSB-PA598712-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against MYC (Ab-58). Recognizes MYC (Ab-58) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:200

YWHAZ (Ab-58) Antibody

EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against YWHAZ (Ab-58). Recognizes YWHAZ (Ab-58) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:200

YWHAZ (Ab-58) Antibody

CSB-PA985974-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against YWHAZ (Ab-58). Recognizes YWHAZ (Ab-58) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:200

Polyclonal CGI-58 Antibody

APG02565G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CGI-58 . This antibody is tested and proven to work in the following applications:

anti-Myc (Ab-58)

LF-PA20308 100 ul
EUR 334
Description: Rabbit polyclonal to Myc

Human measles virus(MV) antibody (IgG) ELISA Kit

CSB-E05000h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitative indirect ELISA kit for measuring Human measles virus (MV) antibody (IgG) in samples from serum. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human measles virus(MV) antibody (IgG) ELISA Kit

  • EUR 723.00
  • EUR 4883.00
  • EUR 2591.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitative indirect ELISA kit for measuring Human measles virus(MV) antibody (IgG) in samples from serum. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human measles virus(MV) antibody (IgM) ELISA Kit

CSB-E05001h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitative indirect ELISA kit for measuring Human measles virus (MV) antibody (IgM) in samples from serum. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human measles virus(MV) antibody (IgM) ELISA Kit

  • EUR 723.00
  • EUR 4883.00
  • EUR 2591.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitative indirect ELISA kit for measuring Human measles virus(MV) antibody (IgM) in samples from serum. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Human measlesvirus (MV) antibody ( IgG)

EK0255 96 tests
EUR 847
Description: Enzyme-linked immunosorbent assay kit for quantification of Human measlesvirus (MV) antibody ( IgG) in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human measlesvirus (MV) antibody ( IgM )

EK0256 96 tests
EUR 847
Description: Enzyme-linked immunosorbent assay kit for quantification of Human measlesvirus (MV) antibody ( IgM ) in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Measles Virus IgG (MV IgG) ELISA Kit

abx364849-96tests 96 tests
EUR 543
  • Shipped within 5-12 working days.

Human Measles Virus IgM (MV IgM) ELISA Kit

abx364863-96tests 96 tests
EUR 543
  • Shipped within 5-12 working days.

LARGE ELISA Kit| chicken Glycosyltransferase-like protein LARGE

EF012373 96 Tests
EUR 689

LARGE Blocking Peptide

33R-1247 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRYM antibody, catalog no. 70R-1992

Large-CRP OmcBProtein

  • EUR 843.00
  • EUR 439.00
  • EUR 1274.00
  • EUR 1636.00
  • EUR 551.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 1 month.

Large-CRP OmcBProtein

  • EUR 2764.00
  • EUR 1734.00
  • 100 ug
  • 50 ug
  • Shipped within 3 months.

LARGE cloning plasmid

CSB-CL012749HU-10ug 10ug
EUR 745
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2271
  • Sequence: atgctgggaatctgcagggggagacggaaattcttggctgcctcgttgagtcttctctgcatcccagccatcacctggatttacctgttttctgggagcttcgaagatggaaagcccgtgtctctgtcaccgctggagtcccaggcacacagccccaggtacacggcctccagcc
  • Show more
Description: A cloning plasmid for the LARGE gene.

LARGE Rabbit pAb

A19515-100ul 100 ul Ask for price

LARGE Rabbit pAb

A19515-200ul 200 ul Ask for price

LARGE Rabbit pAb

A19515-20ul 20 ul Ask for price

LARGE Rabbit pAb

A19515-50ul 50 ul
EUR 308

anti- LARGE antibody

FNab04697 100µg
EUR 548.75
  • Immunogen: like-glycosyltransferase
  • Uniprot ID: O95461
  • Gene ID: 9215
  • Research Area: Metabolism
Description: Antibody raised against LARGE

Anti-LARGE antibody

PAab04697 100 ug
EUR 386

Anti-LARGE antibody

STJ11100708 50 µl
EUR 287
Description: This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein.

Spatulas (Large Pack)

SPAT1 50pack
EUR 301
Description: Individually wrapped spatulas. RNase/DNase free, non-pyrogenic, antistatic, sterile, plastic. Pack of 50.

a.a.), TRAIL/APO 2 Ligand (114-281 a.a.) Human Recombinant Protein, Active

PROTP50591-2 Regular: 10ug
EUR 317
Description: Soluble TNF-related apoptosis-inducing ligand Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 169 amino acids _x000D_ (114-281) and having a molecular mass of 19.6 kDa._x000D_ The sTRAIL is purified by proprietary chromatographic techniques.

Recombinant Human Omentin 298 a.a.

7-01318 5µg Ask for price

Recombinant Human Omentin 298 a.a.

7-01319 20µg Ask for price

Recombinant Human Omentin 298 a.a.

7-01320 1mg Ask for price

Ubiquitin (A.A. 50-65) Antibody

abx023804-01ml 0.1 ml
EUR 1386
  • Shipped within 5-10 working days.

HBcAg (a.a. 1-10) Antibody

abx021792-100ug 100 ug
EUR 565
  • Shipped within 5-10 working days.

HBcAg (a.a. 130-140) Antibody

abx021793-100ug 100 ug
EUR 565
  • Shipped within 5-10 working days.

HBcAg (a.a. 135-140) Antibody

abx021794-100ug 100 ug
EUR 551
  • Shipped within 5-10 working days.

HBcAg (a.a. 138-145) Antibody

abx021796-100ug 100 ug
EUR 578
  • Shipped within 5-10 working days.

HBcAg (a.a. 70-80) Antibody

abx021797-100ug 100 ug
EUR 578
  • Shipped within 5-10 working days.

Streptavidin (37-159 a.a) Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Adiponectin (108-244 a.a.) Protein

  • EUR 3530.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAD51D (1-328 a.a.) Protein

  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Calmodulin-2 135 a.a. Protein

  • EUR 230.00
  • EUR 1790.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

Oncostatin-M (209 a.a.) Protein

  • EUR 328.00
  • EUR 5826.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Oncostatin-M (195 a.a.) Protein

  • EUR 328.00
  • EUR 5826.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Interferon gamma 139 a.a Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Haptoglobin (19-347 a.a) Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

The gene polymorphisms of the VDR appear to be an important genetic determinant in the progression of diabetes. Considering the important predisposition risk factor, we observed that Taq-1 and BSM-1 were strongly associated with Northern Indian diabetes. But requires a subsequent study as a probable genetic risk marker for diabetes.

Leave A Comment